ID: 969518718_969518723

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 969518718 969518723
Species Human (GRCh38) Human (GRCh38)
Location 4:7663534-7663556 4:7663561-7663583
Sequence CCACGTACCCTCTGTGTACACTG CTGCCTCCTCTGAACAGACCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 101} {0: 1, 1: 0, 2: 2, 3: 18, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!