ID: 969526881_969526885

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 969526881 969526885
Species Human (GRCh38) Human (GRCh38)
Location 4:7708377-7708399 4:7708393-7708415
Sequence CCCGGGTGGGTGGGAGCGTTATT CGTTATTCCCAAGAAGGCGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 2, 4: 41}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!