ID: 969533185_969533188

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 969533185 969533188
Species Human (GRCh38) Human (GRCh38)
Location 4:7740686-7740708 4:7740700-7740722
Sequence CCTCCCTGACTTTGCTTCTTCAC CTTCTTCACTCCCACCTGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 363} {0: 1, 1: 1, 2: 3, 3: 37, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!