ID: 969552219_969552221

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 969552219 969552221
Species Human (GRCh38) Human (GRCh38)
Location 4:7878098-7878120 4:7878132-7878154
Sequence CCAATTCTCCATTTTAAACTTTT GTCTTTCCCCTTAAGATCTAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 65, 4: 839} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!