ID: 969569396_969569403

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 969569396 969569403
Species Human (GRCh38) Human (GRCh38)
Location 4:7999835-7999857 4:7999857-7999879
Sequence CCATAGCCACCTTGCCCTCAGCA ACCCCGCCAGGCCTGCTCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 293} {0: 1, 1: 0, 2: 2, 3: 20, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!