ID: 969573411_969573415

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 969573411 969573415
Species Human (GRCh38) Human (GRCh38)
Location 4:8023192-8023214 4:8023216-8023238
Sequence CCATCACTAGGGTGCCCACAGAT GGTGCCACCTGCACGCCGCACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 11, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!