ID: 969573439_969573444

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 969573439 969573444
Species Human (GRCh38) Human (GRCh38)
Location 4:8023322-8023344 4:8023358-8023380
Sequence CCCAAGGCTCCTCTCGGCTGCGA TTCCTTGTGTCTGAGGACTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 81, 4: 335} {0: 1, 1: 0, 2: 1, 3: 30, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!