ID: 969581996_969582000

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 969581996 969582000
Species Human (GRCh38) Human (GRCh38)
Location 4:8071146-8071168 4:8071169-8071191
Sequence CCCAGCTCCCTCTGTGGGGGCAG CGCCATCCGTCCCCAGCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 38, 4: 299} {0: 1, 1: 0, 2: 1, 3: 11, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!