ID: 969584133_969584143

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 969584133 969584143
Species Human (GRCh38) Human (GRCh38)
Location 4:8082239-8082261 4:8082286-8082308
Sequence CCCGACGTGCTGGGTACAAATCC CACTGAGCGTATTCCTCCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 276} {0: 1, 1: 0, 2: 1, 3: 5, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!