ID: 969588251_969588257

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 969588251 969588257
Species Human (GRCh38) Human (GRCh38)
Location 4:8106980-8107002 4:8107000-8107022
Sequence CCAACCACTGCTGCCTTAACCTG CTGGCACGACCTTACCCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 237} {0: 1, 1: 0, 2: 0, 3: 2, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!