ID: 969594685_969594695

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 969594685 969594695
Species Human (GRCh38) Human (GRCh38)
Location 4:8142360-8142382 4:8142404-8142426
Sequence CCAGCACCGAGGTGCAGCCCAGG TACGATGACTCTCCACCTTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 242} {0: 1, 1: 0, 2: 0, 3: 8, 4: 40}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!