ID: 969595968_969595979

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 969595968 969595979
Species Human (GRCh38) Human (GRCh38)
Location 4:8149474-8149496 4:8149513-8149535
Sequence CCCAGCTTGGTCTGTGTCCACAG GAAGCAGAGGGCCTAGAGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 221} {0: 1, 1: 1, 2: 5, 3: 23, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!