ID: 969602158_969602170

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 969602158 969602170
Species Human (GRCh38) Human (GRCh38)
Location 4:8182883-8182905 4:8182922-8182944
Sequence CCCTCATGGGGCCAGGGTTCCCA AGACCGCCTTCTCTCAGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 202} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!