ID: 969603376_969603390

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 969603376 969603390
Species Human (GRCh38) Human (GRCh38)
Location 4:8189829-8189851 4:8189870-8189892
Sequence CCCCGCACAGAGTGTGGCCCTTA GGGAGGAGGAGGCTGGGAAACGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 26, 3: 306, 4: 4104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!