ID: 969611992_969611997

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 969611992 969611997
Species Human (GRCh38) Human (GRCh38)
Location 4:8232592-8232614 4:8232625-8232647
Sequence CCTGCTTCCCTGGGGCAGGGTTT CATCCCACATGTGGCCCACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 419} {0: 1, 1: 0, 2: 1, 3: 10, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!