ID: 969644536_969644543

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 969644536 969644543
Species Human (GRCh38) Human (GRCh38)
Location 4:8419818-8419840 4:8419857-8419879
Sequence CCAGTTCCACACTGCCAGTCACC TACAAACCCCAGTGTCATGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 175} {0: 1, 1: 0, 2: 0, 3: 7, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!