ID: 969646974_969646982

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 969646974 969646982
Species Human (GRCh38) Human (GRCh38)
Location 4:8436443-8436465 4:8436481-8436503
Sequence CCCTCCAACTGCATGGAGAATTA CTGTTAAGATCTAGGAAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 27, 4: 201} {0: 1, 1: 0, 2: 2, 3: 26, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!