ID: 969648367_969648375

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 969648367 969648375
Species Human (GRCh38) Human (GRCh38)
Location 4:8447567-8447589 4:8447607-8447629
Sequence CCTGGCCCTCTGTCTACTCACCT TTCCTGAGCCTCTGAGGAGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 62, 4: 1161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!