ID: 969657838_969657843

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 969657838 969657843
Species Human (GRCh38) Human (GRCh38)
Location 4:8508359-8508381 4:8508381-8508403
Sequence CCCTGAGGGTGGGTCTGGGTGCC CATGGGTTGTGTCTGTTGTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 23, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!