ID: 969669407_969669411

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 969669407 969669411
Species Human (GRCh38) Human (GRCh38)
Location 4:8581503-8581525 4:8581519-8581541
Sequence CCACGCTCCATGCCGTGGGCTTC GGGCTTCGTGCTGCCGCTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 110} {0: 1, 1: 0, 2: 1, 3: 14, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!