ID: 969671939_969671941

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 969671939 969671941
Species Human (GRCh38) Human (GRCh38)
Location 4:8594443-8594465 4:8594472-8594494
Sequence CCTAGGGTCTGGGATTCAGATTC CTCAACTCTGCTGTGTGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 188} {0: 1, 1: 0, 2: 9, 3: 28, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!