ID: 969674567_969674579

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 969674567 969674579
Species Human (GRCh38) Human (GRCh38)
Location 4:8607752-8607774 4:8607781-8607803
Sequence CCCAGTGCTTCCCACCGCAGAGG TTTCCGGGAGGCGCCGGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 135} {0: 1, 1: 0, 2: 0, 3: 13, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!