ID: 969684835_969684844

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 969684835 969684844
Species Human (GRCh38) Human (GRCh38)
Location 4:8665614-8665636 4:8665662-8665684
Sequence CCTGGCTGTGCCTCTGTATCCAG TTCGGCTCCGCTGATCCAGTCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!