ID: 969689714_969689725

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 969689714 969689725
Species Human (GRCh38) Human (GRCh38)
Location 4:8697855-8697877 4:8697886-8697908
Sequence CCTTCCTGCTTCTCCTGCTCCTG CCACTGCCCTGGCCTCTGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 21, 3: 248, 4: 2191} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!