ID: 969725060_969725066

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 969725060 969725066
Species Human (GRCh38) Human (GRCh38)
Location 4:8913861-8913883 4:8913884-8913906
Sequence CCTTAATCCAACATGACCGGTGT CCCCATAAAAGGTGGATGTTTGG
Strand - +
Off-target summary {0: 1, 1: 50, 2: 402, 3: 1245, 4: 2020} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!