|
Left Crispr |
Right Crispr |
Crispr ID |
969744495 |
969744504 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:9059469-9059491
|
4:9059510-9059532
|
Sequence |
CCACTCTCTCATGATCACGACCC |
AGAGTTGTGAGCCCTTAAAAGGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 304, 1: 454, 2: 278, 3: 108, 4: 184} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|