ID: 969744495_969744505

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 969744495 969744505
Species Human (GRCh38) Human (GRCh38)
Location 4:9059469-9059491 4:9059515-9059537
Sequence CCACTCTCTCATGATCACGACCC TGTGAGCCCTTAAAAGGGACAGG
Strand - +
Off-target summary No data {0: 278, 1: 235, 2: 196, 3: 130, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!