ID: 969748364_969748371

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 969748364 969748371
Species Human (GRCh38) Human (GRCh38)
Location 4:9091720-9091742 4:9091760-9091782
Sequence CCATTAGCTGCCAGTAGCACCAC ACCAAAACTGTCTCCAGACATGG
Strand - +
Off-target summary {0: 9, 1: 2, 2: 31, 3: 202, 4: 669} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!