ID: 969779018_969779025

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 969779018 969779025
Species Human (GRCh38) Human (GRCh38)
Location 4:9381439-9381461 4:9381489-9381511
Sequence CCATGAGGTGGCAGCACAGGACG GAATCACTGAAATTCAGGTGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!