ID: 969811258_969811264

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 969811258 969811264
Species Human (GRCh38) Human (GRCh38)
Location 4:9650149-9650171 4:9650176-9650198
Sequence CCTTCACAATAGACCTTAATATT CCTCCTGGTGTTATTCATTGTGG
Strand - +
Off-target summary {0: 2, 1: 7, 2: 2, 3: 19, 4: 208} {0: 8, 1: 5, 2: 1, 3: 9, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!