ID: 969817596_969817598

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 969817596 969817598
Species Human (GRCh38) Human (GRCh38)
Location 4:9698022-9698044 4:9698035-9698057
Sequence CCTCGGGAGGCTCCGTCACACTC CGTCACACTCTCCGAGAGTACGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 6, 3: 12, 4: 77} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!