ID: 969826783_969826793

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 969826783 969826793
Species Human (GRCh38) Human (GRCh38)
Location 4:9764105-9764127 4:9764155-9764177
Sequence CCCCTGGAGCCGCCTTCCTCTGG GTTGTCATTGTTCAAGCCAGGGG
Strand - +
Off-target summary No data {0: 7, 1: 0, 2: 1, 3: 6, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!