ID: 969829445_969829449

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 969829445 969829449
Species Human (GRCh38) Human (GRCh38)
Location 4:9782745-9782767 4:9782781-9782803
Sequence CCATCATGATCGTGACCTACACG TCGCCCAGGTGCAGATCCGCAGG
Strand - +
Off-target summary {0: 6, 1: 0, 2: 0, 3: 2, 4: 24} {0: 5, 1: 1, 2: 0, 3: 2, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!