ID: 969842077_969842082

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 969842077 969842082
Species Human (GRCh38) Human (GRCh38)
Location 4:9890069-9890091 4:9890097-9890119
Sequence CCCCTGGATGAAGGGACGACTGT TTTAGAGATGAGGCCCGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 91} {0: 1, 1: 0, 2: 5, 3: 63, 4: 355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!