ID: 969843040_969843043

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 969843040 969843043
Species Human (GRCh38) Human (GRCh38)
Location 4:9897578-9897600 4:9897603-9897625
Sequence CCAATGGAAAAGGGAAAGTGTGG ACGGAGACAGACACGCACACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 262} {0: 1, 1: 0, 2: 16, 3: 108, 4: 622}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!