|
Left Crispr |
Right Crispr |
| Crispr ID |
969851613 |
969851616 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:9961776-9961798
|
4:9961823-9961845
|
| Sequence |
CCTACAGAATGGAAGAAAATTTT |
TCTAATATCCAGAGTCTAGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 257, 1: 9645, 2: 15596, 3: 11258, 4: 7596} |
{0: 5, 1: 262, 2: 1831, 3: 5135, 4: 4692} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|