ID: 969862218_969862223

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 969862218 969862223
Species Human (GRCh38) Human (GRCh38)
Location 4:10046523-10046545 4:10046548-10046570
Sequence CCTCCCACTATGTGTGGGGATTA ATTCAAGATGAGATGTAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 63, 3: 669, 4: 2928} {0: 7, 1: 415, 2: 8656, 3: 11701, 4: 10264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!