|
Left Crispr |
Right Crispr |
| Crispr ID |
969862218 |
969862224 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:10046523-10046545
|
4:10046549-10046571
|
| Sequence |
CCTCCCACTATGTGTGGGGATTA |
TTCAAGATGAGATGTAGGTGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 63, 3: 669, 4: 2928} |
{0: 6, 1: 421, 2: 8633, 3: 11705, 4: 9744} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|