ID: 969912257_969912266

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 969912257 969912266
Species Human (GRCh38) Human (GRCh38)
Location 4:10457365-10457387 4:10457393-10457415
Sequence CCGCCGGCCGCAGACCGCCGGCG CCCGCTGTAGGTCCCTACCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 109} {0: 1, 1: 0, 2: 1, 3: 6, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!