ID: 969921947_969921957

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 969921947 969921957
Species Human (GRCh38) Human (GRCh38)
Location 4:10548642-10548664 4:10548677-10548699
Sequence CCCCAAGTTGATTTAATCCACCC CTTGCATGGTGTGAGGAACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 101} {0: 1, 1: 0, 2: 0, 3: 9, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!