ID: 969922911_969922920

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 969922911 969922920
Species Human (GRCh38) Human (GRCh38)
Location 4:10557527-10557549 4:10557558-10557580
Sequence CCCTCATCCCTCTGCATCTAGGG AGCCCCGCTGCTGTCAGCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 187} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!