ID: 969926202_969926208

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 969926202 969926208
Species Human (GRCh38) Human (GRCh38)
Location 4:10587893-10587915 4:10587941-10587963
Sequence CCTTGTGGTTAACAGTTGGCGCC GAAATTAGCAGTAAATCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56} {0: 1, 1: 0, 2: 0, 3: 12, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!