ID: 970001842_970001846

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 970001842 970001846
Species Human (GRCh38) Human (GRCh38)
Location 4:11372611-11372633 4:11372641-11372663
Sequence CCAGATGAAGCTGAGAAGGCGCT ATGGATGGAGGACAAATTGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 99} {0: 1, 1: 1, 2: 3, 3: 64, 4: 488}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!