ID: 970005244_970005252

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 970005244 970005252
Species Human (GRCh38) Human (GRCh38)
Location 4:11404665-11404687 4:11404715-11404737
Sequence CCCTCAAGAAACAAACCAGGTAA TTGAAGCACTTGGCTGATGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 2, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!