ID: 970007789_970007797

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 970007789 970007797
Species Human (GRCh38) Human (GRCh38)
Location 4:11427789-11427811 4:11427827-11427849
Sequence CCCGCGCCGGCACCCGGCTTTGG CCCATCATCCGCCTACGTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 114} {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!