ID: 970159095_970159097

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 970159095 970159097
Species Human (GRCh38) Human (GRCh38)
Location 4:13171286-13171308 4:13171302-13171324
Sequence CCTGTGGACACAGTCACAGATGT CAGATGTGGTAGTAGAGCCCCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!