ID: 970180163_970180170

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 970180163 970180170
Species Human (GRCh38) Human (GRCh38)
Location 4:13383809-13383831 4:13383837-13383859
Sequence CCCACAGGAGATTTTAGCCCTAG CTGTCAGACCTGAATGATGCAGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 49, 3: 96, 4: 173} {0: 1, 1: 0, 2: 2, 3: 35, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!