ID: 970180164_970180174

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 970180164 970180174
Species Human (GRCh38) Human (GRCh38)
Location 4:13383810-13383832 4:13383860-13383882
Sequence CCACAGGAGATTTTAGCCCTAGG GCAGTCCTGCCTATCACACAGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 49, 3: 117, 4: 187} {0: 1, 1: 0, 2: 3, 3: 25, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!