ID: 970180925_970180928

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 970180925 970180928
Species Human (GRCh38) Human (GRCh38)
Location 4:13392434-13392456 4:13392470-13392492
Sequence CCCATACAAGAAATAACTTTTCT AGGTAAATACAGAAGAAACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 418} {0: 1, 1: 0, 2: 3, 3: 32, 4: 419}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!