ID: 970192521_970192536

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 970192521 970192536
Species Human (GRCh38) Human (GRCh38)
Location 4:13529666-13529688 4:13529709-13529731
Sequence CCCGCACCCCTGTGGGATTCTCC GTCCCCACCCTAGGAGTGGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!